Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12132G11
Clone ID IST12132G11
Vector VICTR76
Project tigm

Sequence tag IST12132G11BBF1
Sequence
AGAGCACCCGACTGCTCTTCCGAAGGTCCAGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCCGTAATGAG
ATCTGTCG
Sequence Type genomic DNA
Unitrap ID UNI30597 UNI32247

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 46875198..46875285 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023973 (Cnpy3) NM_028065 canopy 3 homolog (zebrafish) Gene [Source:MGI (curated);Acc:Cnpy3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 17498041..17498128 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 63988424..63988511 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 48701330..48701417 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043505 (Gimap5) NM_175035 GTPase, IMAP family member 5 Gene [Source:MGI (curated);Acc:Gimap5-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 133592433..133592520 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 72519082..72519169 86
NO GENE  


Sequence tag IST12132G11HMF2
Sequence
AGAGCACCCGACTGCTCTTCCGAAGGTCCAGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCCGTAATGAG
ATCTGATGCCCTCTTCTGGTGTCTGAAGACAGCTACAGTGTACTTACATATAATCAATAAATAAATTATAAAAAAAAANN
TNNAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 88179296..88179470 167
NO GENE  

 
Come back to gene ENSMUSG00000043505


For any suggestions or comments, please send an email to unitrap@crg.es