Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14472C6
Clone ID IST14472C6
Vector VICTR74
Project tigm

Sequence tag IST14472C6HMR1
Sequence
CTGGCCTCNAACTTCTGATCCTCTTGCCTCTACTACTATGCCTGCTTTTCGTGGGGACTGAACCTAATTCTTAATACATG
CTAGGCAACCATTCCACCAACCAAGCTACATCCCCAGCATACCCCCTCTTTGTTTTATTAAATGAACCTCATATATTGCT
ATACCACTACAACCCAAGAAACCATACCGTTTTGAGTATATTCCC
Sequence Type genomic DNA
Unitrap ID UNI563

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77927999..77928202 202
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037750 (BC017647) NM_145430 Uncharacterized protein C17orf63 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6P539]


Sequence tag IST14472C6HMF1
Sequence
NNNNNCCTAGGCTGANANACCTGGGACTGACTGACCTATGTCGGGAGCGCCCGTGGAGGAGCAGGGCACGGTGGATCAAG
CTTCTGACTCTATTGAGGAGGCATCTGAGTTCAAGGAAAGCGTGGATTACAGTGTGAGTTCAGGCTAGCACCGACAGCAA
GGTGAAACCCTAGCTCAAACTCAGANCAAAACAGCAAATAAACCAGANGGACACCTTGGCTGGTAAATCATTCCTACAAC
TAAATAATTCAGANCTCCATGGAAAAGTCGTTAGCTGATAAACCCGGAAAAATAAAAAGCTCGAAGATGGGTGANGTATT
CNAAAGGGACACTGTGGTACACACCTCCCTGATCCTCAGANNGCCCCCTACCTCTGTGGTTNANGATGCTTGNGCTGTGT
GTGTTNGANTGGGCTGNTGNTNGNANNANNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77927585..77927998 384
 
EST/CDNA Est Name
  CO039437.1


Sequence tag IST14472C6BBF1
Sequence
NTNNNCCTAGGCTGAGAGACCTGGGACTGACTGACCTATGTCGGGAGCGCCCGTGGAGGAGCAGGGCACGGTGGATCAAG
CTTCTGACTCTATTGAGGAGGCATCTGAGTTCAAGGAAAGCGTGGATTACAGTGTGAGTTCAGGCTAGCACCGACAGCAA
GGTGAAACCCTAGCTCAAACTCAGAACAAAACAGCAAATAAACCAGAAGGACACCTTGGCTGGTAAATCATTCCTACAAC
TAANTANTNNANAACTCCATGGAAAAGTCGTTAGCTGATAAACCCGGAAAAATAAAAAGCTCGAAGATGGGTGAGGTATT
CAAAAGGGACACTGTGGTACACACCTCCCTGATCCTCAGAAGGCCCCCTACCTCTGTGGTTTANGATGCTTGGGCTGTGT
GTGTTGGAGTGGGCTGCTGGTGGGATAAGTTGTTAGTTAATTCCTCATACTGATGGGGTAGCACATGGTAGAAAAAGAAA
AAAAGCNNNCATCTTGAAAAAGTTTCACACACNTACNCAAAATGAGACAGCNAGCTNGCGGANCNNGCATGATTTGNCNT
CTTTAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77927438..77927998 525
 
EST/CDNA Est Name
  CO039437.1

 
Come back to gene CO039437.1


For any suggestions or comments, please send an email to unitrap@crg.es