Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15074H7
Clone ID IST15074H7
Vector VICTR80
Project tigm

Sequence tag IST15074H7HMR1
Sequence
AATACCCCTACTGTGGGTACATATTGTAGTATGTCCCTTCCTCTTTGTATAATTCTCAAGGCCCAAGTTTCTACTGTCTG
GGATAGGCTAGGCTCCCTACCTCCTGCTTGTAACCTTTTTTTTTTTTA
Sequence Type genomic DNA
Unitrap ID UNI32248

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 12213707..12213833 127
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023826 (Park2) NP_057903 Parkinson disease (autosomal recessive, juvenile) 2, parkin Gene [Source:MGI Symbol;Acc:MGI:1355296]


Sequence tag IST15074H7BBF1
Sequence
TGTTTTTATATTTAAAATTTTTCTTTANGTGGTTGGTCTACATATATGTCNTTGTCCCACTTGNGTNCCANTGACATTAN
ATGCCCTGGAACTGGAATCCCTGAACTGANGTACANACNATTGGGANACATCATGTGGGTACTGGGANTCNAACCCANGT
CCTCTGGAANANCANCCNNTGNCCTTGACTGNNNANCCNTCTCCTCACCCACAANTTTGCCGGGTTTNNNNNCNTCTATT
TGTANATCANTCCTACTACAACTAACCTTCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15074H7HMF2
Sequence
TTATCACCGGTAGTAGGAAAAATGAGCCGCTTTGTAATTCCAGAGCTTGGCAGGTGGAAACAGAGGCTACCAGAGCAAGC
TGGTATCAACCTTGGGCCTCCATGAGCACACGTGCACAGGCCCCTCCACATGCACACACACCCCTCCACAAACAGCAGAG
GCAAGTCAGTCACCTTCAGGATAGGATATGGATAAGGTCATCGTCGGCATTTGCCTAGCATTTGGAGGCCTTGGTTCAAT
TTCTAGCACTAAACTAAAACAAAACAAAATTAAAAAAAGAACCNAAGAGATGGCTCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 40601687..40601982 294
NO GENE  

 
Come back to gene ENSMUSG00000023826


For any suggestions or comments, please send an email to unitrap@crg.es