Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P085G01
Clone ID P085G01
Vector FlipROSACeoC-2
Project ggtc

Sequence tag P085G01
Sequence
CTGCCCGACCGCTCTTGCTGCTGCCGGTGGATGCTGCGCCTCTCGGAGCGCAATATGAAGGTGCTCTTCGCCGCCGCCCT
CATCGTGGGCTCCGTCGTCTTCCTTTTGCTGCCCGGACCCTCCGTGGCCAACGATAAGAAGAAGGGACCTAAAGTCACAG
TCAAGGTATACTTTGATTTACAAATGGGAGATGAATCTGTAGGTCGAGTCGTCTTTGGTCTCTGAGGAANNGGCTGTTCC
AAAANNCAGTGGATAATTGAGTAGCNTNNGNTACAGGAGA
Sequence Type mRNA
Unitrap ID UNI9491

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 65908043..65909386 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032383 (Ppib) NM_011149 peptidylprolyl isomerase B Gene [Source:MGI Symbol;Acc:MGI:97750]

 
Come back to gene ENSMUSG00000032383


For any suggestions or comments, please send an email to unitrap@crg.es