Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13650E8
Clone ID IST13650E8
Vector VICTR74
Project tigm

Sequence tag IST13650E8BBF1
Sequence
GGAGGTAACNAAAACTGCCCAATCATTANATGCGGCTGCCAAGGTTTGAACCTGTGCAGCGGTATAAGGTACAATTAAAA
GATATGGACTTTGCCCAAAGTGGGTGATTGCTGCTTTTAGGCCTTTAAGGGCAAGCTGTGCAATTGCATCAGGATACCAA
TCTATTATTTTAGCTGGGGATACGTTTGGATGGATCT
Sequence Type genomic DNA
Unitrap ID UNI32250 UNI32251 UNI32252 UNI32253

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166406: 157820..158015 192
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161916: 361807..362002 192
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 2133130..2133325 192
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 6864074..6864269 192
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 6347666..6347861 192
 
EST/CDNA Est Name
  AA008436.1 - AA980996.1 - CX121682.1 - BB567266.1 - CX120623.1 - CX120504.1 - CX121796.1 - CX121513.1 - CX120760.1 - CA464454.1 - CX121473.1 - CX120522.1 - AA007939.1 - CX121288.1 - CX120678.1 - CX122093.1 - CX121475.1 - AA014658.1 - CX121747.1 - CX120382
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 36767961..36768156 192
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 20905410..20905605 192
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 8471664..8471859 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052551 (Adarb2) NP_443209 adenosine deaminase, RNA-specific, B2 Gene [Source:MGI Symbol;Acc:MGI:2151118]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 53833892..53834087 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061603 (Akap6) NM_198111 A kinase (PRKA) anchor protein 6 Gene [Source:MGI Symbol;Acc:MGI:3050566]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 22238060..22238255 192
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 3464101..3464296 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025898 (Cwf19l2) NM_027545 CWF19-like 2, cell cycle control (S. pombe) Gene [Source:MGI Symbol;Acc:MGI:1918023]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 19841185..19841380 192
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 55438139..55438334 192
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 13713229..13713424 192
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 3137434..3137629 192
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4409843..4410038 192
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 12167090..12167285 192
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 4813466..4813661 192
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 60296577..60296772 192
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 22143883..22144078 192
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 26191531..26191726 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026930 (Gpsm1) NM_153410 G-protein signalling modulator 1 (AGS3-like, C. elegans) Gene [Source:MGI (curated);Acc:Gpsm1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 26408814..26409009 192
NO GENE  

 
Come back to gene ENSMUSG00000026930


For any suggestions or comments, please send an email to unitrap@crg.es