Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10046C12
Clone ID IST10046C12
Vector VICTR75
Project tigm

Sequence tag IST10046C12HMF2
Sequence
CCTGGTAGATGGCAGAGGAGGGATCCGCCCAACCTTATCGTCAGCTAGTGTTTGCTGACAGCTAACTGACCATGTGCCGC
ATAGATGGCAGATGTTACTCTCTTTAAATTTCCCCAGCACATTGTAAGGCAGGCAAAATTACAGACCTCACTTTATCAGT
GAAGAAACTGAGGTTCAGAGAGATTAGAATCAGAAGCTTTCACCTGTGGCTGCTGGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 45582527..45921193 218
NO GENE  


Sequence tag IST10046C12BBF1
Sequence
AACCCACAGTACCTACCCTGAGCTCAAGAAGACGAACACAGATAACCAGAGTATAGCTGTGTGCTTAGTGCAGCAGGAGT
GCTCAAGGGGAGGGCACTTTCTAGGTTCTGAAAGGTAAATGCAAACTCTTTTCTCCTCCATTAACACAGGAGAGGGGGCA
AGTCATCCATGACAATACCCTATCAGAGAGTCACACCCTATTATCTGCTGGGAATTGTGGATGAAAAACAGGCTATTCAT
ATGAAAATTGAAGGAATTTCTCCTTGGGGCTGCAATGCAAGGGCAATCAGAAGGTTATGGAGTAACTCCAGTTTACCACA
AGAAGACAGCAGGGTGGCTGCCTATAGAGTAAGACCTATATCCCTTAACTTCAGAACCATGTCATCACCATATCTGTCTA
TCTAGGTATGGAAATGGATTATTCAAAGATGGTACTACTGATAGCATGCAGACTGTGAGAC
Sequence Type genomic DNA
Unitrap ID UNI32258

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 149808842..149809308 437
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074736 (OTTMUSG00000015750) NM_001085521 predicted gene, OTTMUSG00000015750 Gene [Source:MGI Symbol;Acc:MGI:3702158]


Sequence tag IST10046C12HMR1
Sequence
GGNNNNNNTGNNATATTTTCTCCNGGATTTTNCNNNTNTTATCCTTTTCNNNNCTANCNNTGCTGCTGCTTTACCTTGCN
NNGNNATGGTTCTTAANCCNNGCNCANTCATGNANTCTTTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000074736


For any suggestions or comments, please send an email to unitrap@crg.es