Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11420B5
Clone ID IST11420B5
Vector VICTR76
Project tigm

Sequence tag IST11420B5HMF1
Sequence
CCTTCCCATCGGCTTCCCTTATGGATCAAGGCAGAGGCCTGATCCAAATCTCTGCCGCGGCCCTCGTCTTCGCATGGGCG
TAAGACTGTAAAGTCTCTTTGACTCCAACCATCCTTTAATGATCAAAGAGGA
Sequence Type genomic DNA
Unitrap ID UNI32259

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 114689519..114689649 131
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052724 (AC163344.2) Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q8C9E7]

 
Come back to gene ENSMUSG00000052724


For any suggestions or comments, please send an email to unitrap@crg.es