Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12312G5
Clone ID IST12312G5
Vector VICTR76
Project tigm

Sequence tag IST12312G5BBF1
Sequence
CTCCTATCAGATTGGCCTGTAGGCAAGCCTGTGGATCATTTTCCTGATTAATGTGAGAGGGACCAGCCCACTGTGGACCA
TGCTAACCCTGGGCTGCATAAGAAAGCTAGGAACTGATCAAGCCTTAGGGACAAACCAGGATCTCCGTACCAGTTTCTTC
CTCAGGCTCCCCCATTGATGGACTGTGTATGGTTGACGTATTAGCTAGCTAGATAAGCCCTTTCCTCCCCAAGTTGCTTT
TGGTCACAGTTCTTATCACAGCATAGAAAGCAAATTGGAATACCCCTTCCACCACCTCTTTTTTTTATTTTTGGGCAAGA
TCTGT
Sequence Type genomic DNA
Unitrap ID UNI18165

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 21154269..21154592 324
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020128 (Vps54) NM_139061 vacuolar protein sorting 54 (yeast) Gene [Source:MGI (curated);Acc:Vps54-001]


Sequence tag IST12312G5HMF2
Sequence
GGCAGGGCCACAGATACTGAGTGATGCTGGGGGAACTGGATGGGGCCACGGGTACNNNGTCTGGGTTTCTTTGGGACCCG
ACCATTAGCAGGGCTGGGACTGGAACAGTGGAATTAGCAATTAGGCCAAGAGGTCCGANGNNNTCCAGTCTTTCTCGGTC
TCGGGAAAGCAGGTGTGAGCTCAGCCTAGTCACCAATGTGGAGCTGCAGGGAAAGTGACACCCCACTCCCTGCTGTTTAC
ATCGCTTACAGCAGTTGGCCTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 147457455..147457717 249
 
EST/CDNA Est Name
  BM932720.1 - BE860611.1 - BY045643.1 - BY165187.1 - W57121.1 - BY318819.1 - BY039783.1 - BY143926.1 - BY161972.1 - BY168942.1 - BY170446.1

 
Come back to gene BM932720.1 - BE860611.1 - BY045643.1 - BY165187.1 - W57121.1 - BY318819.1 - BY039783.1 - BY143926.1 - BY161972.1 - BY168942.1 - BY170446.1


For any suggestions or comments, please send an email to unitrap@crg.es