Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10255H12
Clone ID IST10255H12
Vector VICTR76
Project tigm

Sequence tag IST10255H12BBF1
Sequence
CAAGCCATTGTGATCTTCCCTCCTCAGATGATCTTTCAAGAGGACAACCCAGGTGTTTTTTATCAGTATGTCATCTCTTC
CCCTCCTGCAGTCCTAGAGAGTCCTTCCACAAAGCCTCCAGCCCTTCAGCCTCAGCCTGGTAAAACTAGGATCT
Sequence Type genomic DNA
Unitrap ID UNI32246

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95484933..95485085 153
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015850 (Adamtsl4) NM_144899 ADAMTS-like 4 Gene [Source:MGI (curated);Acc:Adamtsl4-001]


Sequence tag IST10255H12HMF1
Sequence
CAAGCCATTGTGATCTTCCCTCCTCAGATGATCTTTCAAGAGGACAACCCAGGTGTTTTTTATCAGTATGTCATCTCTTC
CCCTCCTGCAGTCCTAGAGAGTCCTTCCACAAAGCCTCCAGCCCTTCAGCCTCAGCCTGGTAAAACTAGGATCCCCAGAC
CCAGGAGAGGAGGGTGAGGCAGGGACTGAGCTCCAGGGTAGCAGGGAGGCATCTAATCTGGTCCCTGGATTTCCCTGCAG
AGATGCTGAGGGGGGAGCCCCTACTCCCCTCAGCCCCCCGCCCAGTCCGGGCACCAGGCACCCTCCAACGTCAGGTGCGG
ATTCCCCAAGTGCCTCCTCCGACTCGTGTCAGGACAGCCATGGGGTCTTCTGCTGGATACTGGAAACAAGTGGGGCACTC
TGNGTGTTCAGCATCCTGTGGCAAANGTGAANNNNACACCTCANCCCAAATCCCTGTTCTCTATATATATCTATACAGAT
TCTGTATCCTGGNCCNCGGGTCTACATTGGANCCTATGTCTGGGNNTTNATTGAAACGGGGCTCTGAN
Sequence Type genomic DNA
Unitrap ID UNI32265

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95484538..95485085 518
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015850 (Adamtsl4) NM_144899 ADAMTS-like 4 Gene [Source:MGI (curated);Acc:Adamtsl4-001]

 
Come back to gene ENSMUSG00000015850


For any suggestions or comments, please send an email to unitrap@crg.es