Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12301G7
Clone ID IST12301G7
Vector VICTR76
Project tigm

Sequence tag IST12301G7HMF1
Sequence
CACTGTGGATTTGGAGTCCTGAAGGATTGCTCGGCAGGGCCCTGGTGCACTCTTGATCATTTGAGGCTCTGGTTTTCTCT
TCAGGACACGGGACACGGGGTGGAGCATGGAGATGTCA
Sequence Type genomic DNA
Unitrap ID UNI1421

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106239901..106240017 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023345 (Wdr51a) NM_027354 WD repeat domain 51A Gene [Source:MGI Symbol;Acc:MGI:1917485]

 
Come back to gene ENSMUSG00000023345


For any suggestions or comments, please send an email to unitrap@crg.es