Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P080B01
Clone ID P080B01
Vector FlipROSACeoC-2
Project ggtc

Sequence tag P080B01
Sequence
GGATCTCATTGAACGGGGCCGGACCTACCTAGCGGCCNNNGANNNCCTGGACAACGGCAAGCCTTATGTCATCTCGTACC
TGGTGGATTTGGACATGGTCCTGAAATGTCTCCGTTATTACGCTGNNNGGNNNNACAAGNNNCATGGGAAAACCATTCCC
ATCGACGGCGACTTCTTCAGCTATACCCGCCATGAGCCTGTGGGCGTGTGTGGACAGATCATTCCGTGGAACTTCCCGCT
CCTGATGCAAGCATGGAAACTGGGCCCAGCCCTGGCAACCGGGAACGTGGTGGTGATGAAGGTGGCCGAGCAGACACCGC
TCACCGCGCTCTACGTGGCCAACTTGATCAAGGAGGCAGGCTTTCCCCCTGGCGTGGTCAATATCGTTCCCGGATTCGGC
CCTACCGCCGGGGCTGCCATCGCATCCCATGAGGGTGTGGACAAAGTGGCGTTCACAGGCTCCACGGAG
Sequence Type mRNA
Unitrap ID UNI11307

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 122025100..122029646 131
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029455 (Aldh2) NM_009656 aldehyde dehydrogenase 2, mitochondrial Gene [Source:MGI (curated);Acc:Aldh2-001]

 
Come back to gene ENSMUSG00000029455


For any suggestions or comments, please send an email to unitrap@crg.es