Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AZ0160
Clone ID AZ0160
Vector pGT0lxr
Project sanger

Sequence tag AZ0160
Sequence
AGTGCCCTTCATTCTCCGCAATTACTATGTTTCTATTTCGTACCTTATTCCGTCTTCTTGGTACCCAAGTTCTCTAGATC
TATTCTCTACTCTCCACCCTTCAGGGCTTCAGCCCCCAGCCATCCCACCTATCGGTAGCAGTGCAGGACTTCTGGCCCTC
TCCAGTGCACTAGGAGGTCAGTCTCACCTCCCAATTAAGGATGAGAAGAAGCACCATGACAATGATCACCAAAGAGACAG
AGACTCCATCAAG
Sequence Type mRNA
Unitrap ID UNI1623

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 14590849..14592414 143
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024642 (Tle4) NP_035730 transducin-like enhancer of split 4, homolog of Drosophila E(spl) Gene [Source:MGI Symbol;Acc:MGI:104633]

 
Come back to gene ENSMUSG00000024642


For any suggestions or comments, please send an email to unitrap@crg.es