Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11560D4
Clone ID IST11560D4
Vector VICTR76
Project tigm

Sequence tag IST11560D4HMR1
Sequence
NGGTTTAGCTGTGTCCCTGTAATCCCTTTCTGACCTTAGCCNGTTTTTGAAGCTGCTCCTCTCACATGGTCACCTAGAGA
CATGGTTCCATGCTAAAATACAAAGTGACGCCTGGTCCAAATAGCACGTCCTTCTAGTCCTGACACTGCCGAGGCTGGGA
TGGGATCATCAGAGTCTGTGTCTAGACAAGGTTCCATGGCAAGCTTGATTCAGGTCAGCTTGGGTTACACAGGAAGACCA
TGTCTCAGAGCAAAGTTCACCCCAAATGTTGCAAACTGGTAGTTTTCTAATTCTTTCATGCTTTCTACATTTATCAGTTT
TAAAGAACTTTGCTTTAAAAAAACTAGAGATTGTAGCAAGGTCAGATTTCAAGCAAGTTGGTACCCTAATAGTGTCCAGT
GGGACCCACTTGAGTTGTTTGTTTCTTTTCTGTGAGTCCNTGGACTGGAATGTGGCTGGTGTGCTTTANTCNNCTGAGGT
TTTCTTCTTCTTCTCCATCACCN
Sequence Type genomic DNA
Unitrap ID UNI32271

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 45956014..45956514 491
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034135 (BC033915) NP_081774 Serine/threonine-protein kinase QSK (EC 2.7.11.1)(Salt-inducible kinase 3)(SIK-3)(SIK3) [Source:UniProtKB/Swiss-Prot;Acc:Q6P4S6]

 
Come back to gene ENSMUSG00000034135


For any suggestions or comments, please send an email to unitrap@crg.es