Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14649F10
Clone ID IST14649F10
Vector VICTR74
Project tigm

Sequence tag IST14649F10HMR1
Sequence
ANTGTCCTCATTAAAATGTCTGTGAGAGATTGTGTTGTGTGAAGATTGATGTGGGAAGGAAGGCTCTTCCATTGAGGGTG
GCAG
Sequence Type genomic DNA
Unitrap ID UNI1559

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 121810756..121810837 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078564 (BX000432.7) Novel zinc finger protein Fragment [Source:UniProtKB/TrEMBL;Acc:B1AZK8]


Sequence tag IST14649F10BBF1
Sequence
ATTTNNNNGANAGANAACTGCAGGCGCCAAAGTGTTGACNACTTAAGCTAACTAGGACACACAGACAATAATATATCAGA
AAGGTTTAAAAAGCCAAACCTAATGTATTAACCATATCAATCACTTAAGTAGCAAAACCCCAAAAATTGCTGATTGCATC
AACTGGAAAACAGAATTGCCAAAAATGAGGAGAGGAAAGCCTTCAGGATCAAGAAGAGGAAACTAAAACTGTTTCCCAAC
TATCAAAAACTCAAGAAACTCATAGTAAATTTTCAGAAGACAAAAATAGGTAAAGGTCTACTATTTTCCAGAGAAACAAT
ATAATTAGATTATAGTGAATAACATCACACAATGTAGATAGCACCACAAATAAAGAGAAAGCANAAGACAGATAGACGTA
TAAATCTTTTTAAAATGAAGTACAAGACTATAATAAAAAAANATTAAGAAATTACNGGTNNATACTCATCCTGTGTATTC
TGTTTCTCCNCTNTGCCAANAAAACAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 121810845..121811342 476
NO GENE  


Sequence tag IST14649F10HMF1
Sequence
ATTTTAATGAGAGATAACTGCAGGCGCCAAAGTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 121810837..121810872 36
NO GENE  

 
Come back to gene ENSMUSG00000078564


For any suggestions or comments, please send an email to unitrap@crg.es