Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10119D1
Clone ID IST10119D1
Vector VICTR76
Project tigm

Sequence tag IST10119D1BBF2
Sequence
CGTACGGGGGGAGCGAGAGCGCCAGCTATCCAGAGGGTAACTTCGGAGGGAACCAGCTACTAGATGGGTCGATTAGTCTT
TTCCCCTTATACCCAGGTCGGACGACCGATTTGCACGTCAGGACCGCTACGGACCTCCACCAGAGTTTCCTCTGGCTTCG
CCCTGCCCAGGCATAGTTCACCATCTTTCGGGTCCTAACGCGTACGCTCGTGCTCCACCTCCCCGGCGCGGCGGG
Sequence Type genomic DNA
Unitrap ID UNI30685

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 57391416..57391640 211
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075007 (AC144776.2) FIL1L_MOUSE Isoform 2 of Q6P6L0 - Mus musculus (Mouse) [Source:UniprotKB/SpliceVariant;Acc:Q6P6L0-2]


Sequence tag IST10119D1HMF1
Sequence
CTAGAACTCTACATCACCAAGGCTGAGATTGACCTCCAAATCTTCCTGTCTCTACCCACACGTGCTATGACAGGCATGAG
CCTATTATGTTTACGAACTAAAATAGCTGGAGCCCCCTAGCTCTGTAGAGCAGGAGGAATCCCACTAGCCTGAGGATAAA
AAGGTCTCTATGGTTCTTTAAGGCTAGGAGGGGAAAATGCTTTTTTTCTCCCAAATATTGCTCTTTTTACCGTTTCTTCT
AAATTCACCCCCACAATCCCCCACAATACCTGGCTCTTCACACTTCTCCACGCTTTTACTGACTGACTGTTTCTCTTATG
TGGTTTCTCTTATCTGAATTTGCCCCACCGTTCTGTCTTCTGCTTCTTAACTCACCTGANTCCCCAGTTGCCTTANTCTC
TTTCNNAAGGGAAAGTATACGTTGTGAGGAATGTGGAANGCTTGCCTCANNCNCTGCNCTGCTGTGGGTCTGTNCCTCCT
TCCTTTTGCTGGANCTTGGGAGCCNCACATTTNAATTTGCTTTTGTGGTGCTGANGN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 117325458..117325991 508
NO GENE  


Sequence tag IST10119D1BBR1
Sequence
CTAGGCCTGTGTGGATTGCGTGAACGTTCTCAAAACAAACAACAACAAAACCAAACAGACAAATAACAACAACTAACCTC
TGCTCAGAATCTTCCCGTTCTTTTCACCCCAGGCTGAAGCCAGAGCTGGCCCTCACTTTCCCTGGTTTACCGCCTAGCCC
TTTCCCCTCCCCCTCTAGCTCCAGGCCGACTGGCCTTACTGAACTCCTTTCCCAGATCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 117325242..117325461 208
NO GENE  

 
Come back to gene ENSMUSG00000075007


For any suggestions or comments, please send an email to unitrap@crg.es