Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14903A3
Clone ID IST14903A3
Vector VICTR76
Project tigm

Sequence tag IST14903A3HMR1
Sequence
CTCCCTTATTTACAAAACTTGTGAAGCCNAAGATGCTCATCAAGGAGATTATAGACCATGTCTGGGACGTTTATTAATGA
TCATACGGAATTTTAATAACCAATTAATATACATGTGTAGGAAAGATTAATTGGGAGTCCCAGGCTTGTCTGAAATGAGC
CGAGCAACAAAGAATAGGTAACTCAGTAAAGGGAGTGCAGTCTGTTCNAAAGCTATGGGAAAGCANAGCTTAATNNGAAA
CNNGANTTANAGTTACTTANTGTTNNNCNGANTN
Sequence Type genomic DNA
Unitrap ID UNI10427

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 70481516..70481779 244
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018287 (Spag7) NM_172561 sperm associated antigen 7 Gene [Source:MGI (curated);Acc:Spag7-001]


Sequence tag IST14903A3HMF1
Sequence
GGAGTACAGATATTTAACAGTCTTTGAACATTCTGAAAGCATCCTGTCTTGCCTCCTTTGAGCAGATGGGTAGTAGGTGC
GGGTAGGAGACTTATCCACGACCAAGGCTCACGTGGTTGGGAGCTGGATGCACCTAAGGCTATCCTTTCTATAAAGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 70481776..70481931 156
 
EST/CDNA Est Name
  AA152918.1 - BU519348.1 - BQ550093.1


Sequence tag IST14903A3BBF1
Sequence
GGAGTACAGATATTTAACAGTCTTTGAACATTCTGAAAGCATCCTGTCTTGCCTCCTTTGAGCAGATGGGTAGTAGGTGC
GGGTAGGAGACTTATCCACGACCAAGGCTCACGTGGTTGGGAGCTGGATGCACCTAAGGCTATCCTTTCTATAAAGTCCT
TCACATGCGCTCCAAGCCAATACAGGGCAGGCCACTTCGGGCCGCACCCTACCCTGGCTGCCAAACCCCAGCGAGCTTTC
TGGTTAGCTACTCAGCGCGGGGGCTGGGAAGGAGAGATGGCGAATCGGAGCCTGCGGGGCATTCTCATCTCTCCAATCAA
CATCACGATCTANTTGGGCANCACAGGAATTTAAGGCTATAGTTAGGAAAGGGCGGTGGAAGGTATGAGGGACTGGGTCA
ACTCANGANNGGGCATANAGATANGANGATCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 70481776..70482207 416
 
EST/CDNA Est Name
  BE915693.1 - BI657181.1 - BG802996.1 - BB618882.1 - BU514065.1 - CA979942.1 - BU512067.1 - CK022273.1 - CN694965.1 - DV658120.1 - AA980522.1 - BY261455.1 - AI180464.1 - CA467506.1 - AA450486.1 - BB854366.1 - CA469050.1 - AI021447.1 - BY031590.1 - CB951207

 
Come back to gene BE915693.1 - BI657181.1 - BG802996.1 - BB618882.1 - BU514065.1 - CA979942.1 - BU512067.1 - CK022273.1 - CN694965.1 - DV658120.1 - AA980522.1 - BY261455.1 - AI180464.1 - CA467506.1 - AA450486.1 - BB854366.1 - CA469050.1 - AI021447.1 - BY031590.1 - CB951207


For any suggestions or comments, please send an email to unitrap@crg.es