Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P078C11
Clone ID P078C11
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P078C11
Sequence
GCCGCCCGCGGTCCTCCGTCGGTTCTCTCCATAGCCCGCCGTCTCCCACGGAGCTGCCCGTCCTTGGCTCGGAGCTCGCG
GACTCGCGGACAAGCGTCCTCAGCGCGAAGAGGCCGGACTCGGAGTCCTCGCCTTGAG
Sequence Type mRNA
Unitrap ID UNI10758

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108208747..108208884 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007815 (Rhoa) NM_016802 ras homolog gene family, member A Gene [Source:MGI Symbol;Acc:MGI:1096342]

 
Come back to gene ENSMUSG00000007815


For any suggestions or comments, please send an email to unitrap@crg.es