Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12943H4
Clone ID IST12943H4
Vector VICTR76
Project tigm

Sequence tag IST12943H4HMF1
Sequence
CATCAAGTCAGGACAAGAATTCAACAGGGCAGGAACCTGGAGACCTAAAGGCAGGAGCTGATGCAGACGTGGTGCTGCTT
ACTGGCTTGCTTCTCACAGCTTGCTCTCTTATAGAACCTAGGCCCACCAGCCCAAGGATGGTGCTACCCANAATGGGCTA
GA
Sequence Type genomic DNA
Unitrap ID UNI14634

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45587774..45587934 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023935 (Spats1) NP_081925 spermatogenesis associated, serine-rich 1 Gene [Source:MGI Symbol;Acc:MGI:1918270]


Sequence tag IST12943H4BBF1
Sequence
CATCAAGTCAGGACAAGAATTCAACAGGGCAGGAACCTGGAGACCTAAAGGCAGGAGCTGATGCAGACGTGGTGCTGCTT
ACTGGCTTGCTTCTCACAGCTTGCTCTCTTATANAACCTAGGCCCACCAGCCCAAGGNTGGTGCTACCCANAATGGGCTA
GGCTCTCTCACATCAGTTACCAACTAAGAAAATGTCTTACAGACCTGCCAACAACCTCCATTTTATGGAGGCATTTTCTT
TTCTCTCTTTTTTTTTNNTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI14634

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45587665..45587934 260
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023935 (Spats1) NP_081925 spermatogenesis associated, serine-rich 1 Gene [Source:MGI Symbol;Acc:MGI:1918270]

 
Come back to gene ENSMUSG00000023935


For any suggestions or comments, please send an email to unitrap@crg.es