Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14886A9
Clone ID IST14886A9
Vector VICTR76
Project tigm

Sequence tag IST14886A9HMR1
Sequence
GTGTCTGTGGTATGGAACTGAAGGGATTGTTTCCGCACTGAGGGAGACCACCTCGTGTCCTGACATTTAAACATGACCTC
AGCCTTANNNATGCCTATGAATTTTAAATTTATCTTATGTTC
Sequence Type genomic DNA
Unitrap ID UNI9019

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114312465..114312585 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031954 (Cfdp1) NM_011801 craniofacial development protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344403]


Sequence tag IST14886A9BBF1
Sequence
ACACCTCATTTAAAACAGGCCAGCCTGCCCCTTATTAGGAACAGGAGGCACACTAACCGCATGGCACTGCATGAAACACA
TATGACCTAACTCAAATACACTTTGCAGACATTTCCCCAAATCTTTGCTANACTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114312582..114312716 133
NO GENE  


Sequence tag IST14886A9HMF1
Sequence
ACACCTCATTTAAAACAGGCCAGCCTGCCCCTTATTAGGAACAGGAGGCACACTAACCGCATGGCACTGCATGAAACACA
TATGACCTAACTCAAATACACTTTGCAGACATTTCCCCAAATCTTTGCTAGACTCCCCCAACCCCCCCTTACCCTCCCCC
TCTCTCTTTTTTTCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTTCTTTTTCTTCCTTCCTTCCTTTTCTTT
TCTTTCTTTCTTTTTTTTTNGNANNCNGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114312582..114312851 260
 
EST/CDNA Est Name
  AA002285.1 - AA123499.1 - AA140438.1 - AA667223.1

 
Come back to gene AA002285.1 - AA123499.1 - AA140438.1 - AA667223.1


For any suggestions or comments, please send an email to unitrap@crg.es