Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11619C4
Clone ID IST11619C4
Vector VICTR76
Project tigm

Sequence tag IST11619C4HMR1
Sequence
NACTCTCTGACTTTTTGCTTCCTTCTCTTTCTCTTTCATCTCTGTGACTTCTTGCTTCCTCTGTTGGAGTCCTGCTATTG
GCTGACACACCGTAAAATGGTTACTTTTTCTGGTTC
Sequence Type genomic DNA
Unitrap ID UNI30050

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115971987..115972100 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029528 (Pxn) NM_011223 paxillin Gene [Source:MGI (curated);Acc:Pxn-001]


Sequence tag IST11619C4BBF1
Sequence
CTAGCGAGCACTTTCAGTACTATATTGAATAGATATGGGGAGAGTGCCCACCCCATTCTTTTTTAAAGATGGTAGAGTTT
CTTGTANTTTCCATATTGTTANAGAAAGAAGCTATACTCACTCCCACTGCCAANAAATCANAAATAGTCAANTAACAAAA
GATATTTTTCAACTTTGTAATAATTTAAATTTATANAACATTTGCAAAAATAGTAAAGTTCTTATTATATATTCACTTAA
AAGATTTTTTTTTTGGGTTTTTTTTGGGGGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 78345891..78346162 254
NO GENE  

 
Come back to gene ENSMUSG00000029528


For any suggestions or comments, please send an email to unitrap@crg.es