Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12688G4
Clone ID IST12688G4
Vector VICTR76
Project tigm

Sequence tag IST12688G4HMF1
Sequence
AAACCTCTTTCTAGAAAGCTGTTTATCCTGAACTCTATGTGGTCAGCTTCAGAAAAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 76172128..76172194 67
NO GENE  


Sequence tag IST12688G4BBF1
Sequence
GTGGTTTTAGGTCTCAGGAAAGGCAACTTTTTATTCTTCCTTGAGCAGGTGAGGTTGATTAATATTGTAATTGGTGATGG
TTCA
Sequence Type genomic DNA
Unitrap ID UNI32275

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 121630564..121630646 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027238 (Frmd5) NM_172673 FERM domain containing 5 Gene [Source:MGI (curated);Acc:Frmd5-001]

 
Come back to gene ENSMUSG00000027238


For any suggestions or comments, please send an email to unitrap@crg.es