Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P086A02
Clone ID P086A02
Vector FlipROSACeoC-2
Project ggtc

Sequence tag P086A02
Sequence
AACAAGCAGCTATGGAAGTCAGATGATTTTGGCCAGACCTGGATCATGATTCAGGAACACGTAAAGTCCTTCTCTTGGGG
AATCGACCCCTATGATCAGCCAAACGCTATCTACATTGAGCGACATGAACCCTTTGGGTTCTCCACAGTGCTCCGCAGTA
CAGACTTCTTCCAGTCCCGGGAAATCCAGGAAGTGATCCTGGAGGAAGAGAGAGACTTTCAGCCTCGGGCCAAGTACATG
TCAACTACAAAGGAGG
Sequence Type mRNA
Unitrap ID UNI11644

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 41889873..41898099 160
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049313 (Sorl1) NM_011436 sortilin-related receptor, LDLR class A repeats-containing Gene [Source:MGI (curated);Acc:Sorl1-001]

 
Come back to gene ENSMUSG00000049313


For any suggestions or comments, please send an email to unitrap@crg.es