Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14121A2
Clone ID IST14121A2
Vector VICTR74
Project tigm

Sequence tag IST14121A2HMF1
Sequence
GCNCAAAGGCGAGTAAACAGTAAACCAAAATGGCGCCCGGCGTCCTTGAAAAAGCCTCTCTTGGTCNTGTCCCTCCCTGA
GGAGGCCCCTCCCTTCCCTCCGCCTCGTTGAGTGACTGGGAGCGCACGCCAATAGCGTCCCTGGCCCTGCATCCTTTTGG
TTCAACCGCCTATCANCGCGAGCCANAGGGCAAGCGGGGCGGTGCCGCACCCTTTGCGCNCNCCNCN
Sequence Type genomic DNA
Unitrap ID UNI31229

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55222240..55222463 210
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022179 (4931414P19Rik) NM_028890 RIKEN cDNA 4931414P19 gene Gene [Source:MGI Symbol;Acc:MGI:1921609]


Sequence tag IST14121A2HMR1
Sequence
CTTGGTGCTCTACAGTTGTGTGTACACGACTGTAAGTACAGAGGCTGCAAATGAATTTGGTTGGGCTGATTTTTGGGTTC
CATGCCTCCCTCAGTTACTGAGCTTTCGGGTTCTAGTTGCCAAGTAGCAGTTCCTCCTTAATTCGGTTTGCTTTTGGATT
CTCANCAAAATCCACTCANTATTATAGATTTGCTCTTCTTTGGTAAAACTGTCAAACTAACCAAGCCAATCCATGGGATG
GATTCCTCTCTCACAAACAAAACAAAACAAGACAAAACAAAACCGACCTTGGCGACNAGCCTAGATCGCAAGACGTANTC
TAAGCTAAACTGGCTGGCAACTATTGTCTTANGACTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55222464..55222820 347
 
EST/CDNA Est Name
  CJ054917.1 - BY143250.1 - BY044700.1 - CJ185811.1 - BY054307.1 - BY086618.1 - BY146003.1 - BY098745.1 - AI604360.1

 
Come back to gene CJ054917.1 - BY143250.1 - BY044700.1 - CJ185811.1 - BY054307.1 - BY086618.1 - BY146003.1 - BY098745.1 - AI604360.1


For any suggestions or comments, please send an email to unitrap@crg.es