Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P096G01
Clone ID P096G01
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P096G01
Sequence
CCGCAACCCCCGCCGTAGCTGCCGCTGCTCCCGCCGTCACCGCCTCCGAG
Sequence Type mRNA
Unitrap ID UNI1557

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 52174605..52174654 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020402 (Vdac1) NM_011694 voltage-dependent anion channel 1 Gene [Source:MGI (curated);Acc:Vdac1-001]


SPLK-Sequence tag 5SP096G01
Sequence
GATCTGGTCTAGATGCCTGCAGGGTAGGGGCTCTGGGGGGCTGTCTTTTCTGTGAGGTCAGAGAAGAGTAGCAGGAAAGA
CCTGGCTTCTGATAGGCT
Sequence Type genomic DNA
Unitrap ID UNI15257

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 52183387..52183484 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020402 (Vdac1) NM_011694 voltage-dependent anion channel 1 Gene [Source:MGI (curated);Acc:Vdac1-001]


SPLK-Sequence tag 3SP096G01
Sequence
CGATTGGGCTACATAGGACCCTGCCTCAAAAGGAAAAAAAAGAGGCAGGTGTGTAGGCACACTTTCAAGGTTAGCTCAGG
GGTTAAGTAAGAGCACTGTATTT
Sequence Type genomic DNA
Unitrap ID UNI15257

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 52183548..52183650 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020402 (Vdac1) NM_011694 voltage-dependent anion channel 1 Gene [Source:MGI (curated);Acc:Vdac1-001]

 
Come back to gene ENSMUSG00000020402


For any suggestions or comments, please send an email to unitrap@crg.es