Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AY0087
Clone ID AY0087
Vector pGT0lxr
Project sanger

Sequence tag AY0087
Sequence
GATTTTCCTGAGGCCGAAAATAGACCCTGACCACGCGGGAGAGAAGTTGAATTTTTTTTTTTTTTTTCTCATCTCTTGCT
ATCCTCTGTCAGTTTCCCCTGTCCTCCCTGGTATTTCGCTTTTTCTCCAGTTAATCCTCCTTCCTTGTGGCTTGGGGCCG
CCATCTTGGCAAGAGGCGAAGCGGCGGAGGCTCCTGTCAGGGGCGGCAGGTTCGGAGCGGCCAGAGCTCCGCGTCTCTGG
GCAGCAGCCCGAGTCCCCGCAGAGCCAGAGCGCGGCGCAGCGCGCCCCACCTGCGGCCTCACCATG
Sequence Type mRNA
Unitrap ID UNI1630

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 44575753..44575912 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032096 (Arcn1) NM_145985 archain 1 Gene [Source:MGI (curated);Acc:Arcn1-001]

 
Come back to gene ENSMUSG00000032096


For any suggestions or comments, please send an email to unitrap@crg.es