Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14493C1
Clone ID IST14493C1
Vector VICTR74
Project tigm

Sequence tag IST14493C1HMR1
Sequence
CTATCATTTGANCANGAGTGGATTTTGTCTTCTGACTTTGTTCAGGGCCTCACTACATAGCACACTTGCGGGTCTTGAAC
GCTATATAGATCAGGCTGGTCACTACGATCCGCCTGCATTGGACTCGCTGGACTTAGGCAGGTGTCACCATGCCTGACTC
TTCTTTAAATTTTTGTTTTGTTTTTTTTANATTTATTTATTTATTATATGTAAGTACATTGTANCTGTCTTCANACACTC
CANAAGAGGGAGTCANATCTCTTTACGGATGGTTGTGAGCCACCATGTGGTTGCTGGGATTTGAACTCTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4794793..4795102 296
 
EST/CDNA Est Name
  CA491337.1 - BU525160.1


Sequence tag IST14493C1BBF1
Sequence
ATAGCACAGCGACACTTGTGCTTTCTTGAGATACCACAAACTCACTCGAGTGAGTCGGCGGAGGGCCCACTAATTCACAC
TCCGGTGAAGGGGCACGAAGCACAGACTTGGACATTATCGCCCCAGTTTCCCAACTTAATAGAACTAGACTCGCCCCTTC
CTTGCTTCCCAAGCTGCATCTGGCCTTCGTGTCTCACTTCCGGCCTGTGGCTCTCTTCTTCCGCTTCTCTATGGTCGCGA
GCCGGAAGTGGCTACCCGGCTGGAAGGCGTGAGGAGCATTCTGGTGAGCGAGGGTAGAGGGCTGCTGGCTGGGGCTGCAG
GTCCTCGCTGGGCGATCCGGGCTTGATGTGCAGACGGCACGGAGCGTGTCCNCGGGCTGGGGTCCTCACCTGTCGGGGTC
CCCCN
Sequence Type genomic DNA
Unitrap ID UNI19691

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4795099..4795502 402
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034274 (Thoc5) NM_172438 THO complex 5 Gene [Source:MGI (curated);Acc:Thoc5-001]

 
Come back to gene ENSMUSG00000034274


For any suggestions or comments, please send an email to unitrap@crg.es