Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0144
Clone ID GC0144
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0144
Sequence
CTGGGACCACTTAGTGTTTTTGACCTGACAGGAGGCAAGCCCTTTTTCTGGCGCTCTTTCTCCCTTTCCCTGGCTCTGCG
CTCACTGGAGTAGGAGCGTGAGGCTTTTCT
Sequence Type mRNA
Unitrap ID UNI157

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3178246..3178350 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046201 (Rbm16) RNA binding motif protein 16 Gene [Source:MGI Symbol;Acc:MGI:1925212]

 
Come back to gene ENSMUSG00000046201


For any suggestions or comments, please send an email to unitrap@crg.es