Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14727C10
Clone ID IST14727C10
Vector VICTR76
Project tigm

Sequence tag IST14727C10BBF1
Sequence
ATACCCATGAGAAGCATTTGCATCTTTTTTGTGTGATGGTCAGAGCTTTGAGTATGCTAAGCAAGCCCTCTAGCATTGAG
CTGGACCCCAACCCTCCTTTTACTTTGATACGGTCTGACTTGTTCACTCTAAATAGAACTGAAGAAGTGCTTTCAGTAGG
TGTATAATTAACACTGGGGGTCAGTGTGGGTAAAGGGGAAGAGAGCTGAGAGCAGGATATGCCTGCAGTGGGGAGCGTGT
GCTTGGGAGGTAGAATGGGAAATGTTGAAACCACCCACACAGGCCAGCACAATTAATGTGGAGAGGGATTACTAGAATAG
CTCACAGAAAGTGACTTGAACAGTGGGTGGCAGCAGAGGCCTGCTTACATATGCTGCTGGCACAACAGGGTCTTGGTGGT
GGAATCTTTCNCTAANAATTTGTCCATTTATGCTGAACATATGATTTACTANNNGAAAAATCAAN
Sequence Type genomic DNA
Unitrap ID UNI22235

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 21516096..21516559 454
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039357 (Fut11) NM_028428 fucosyltransferase 11 Gene [Source:MGI Symbol;Acc:MGI:1920318]


Sequence tag IST14727C10HMR1
Sequence
TATGGTGGCTCTCTCTGATCACCACAAGTTTGAGGTCAGCCTAGGCTACAGAGTGAGACTCTANTTTGTCTGATTAGTTG
ATTACTGCAGATGGGGAAAATCCTTTCAAAATGCTCTTATTGGGCTGAGTGTGTGACTAGGTAGAAAAATATCCTCCTGG
TATGCANAAAGCCCTGGGTTTAATCACAGCACAACCAAAACTCATCTTTTGTTGTCCGGCTCCCCATCAAAGGTACTCAG
CTCAGGTGCTGATCCTCACGTTGGCTTACAGGCTATTTATAGCCTGGCTCCANTTTATGTGCTCAAGTTTTCTAAACTTC
CCCACACCTCTGGAATAACAGGTGTANCCACCACACCCAGCCCCCCANCTGCTACTGACAACTTAAAGCAAAGTGAGCCC
AATGCGCTAANAAAGCAAGCANTTTGATTTGGCANCTGCNGGACAACCCAGCAACCCCTTTACCTGTCATTCTCGGGAAT
CTCTTCGACTTTCCCAAANCCANGGGTANGCACTGGACAGTTCATGTGCGACGACTGGGCAATGCNAGGCTCGGNGANAN
GAATGTCCNCNTNANANGATNCNTGTNCTTTCTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14727C10HMF1
Sequence
TACCCNTGAGAAGCATTTGCATCTTTTTTGTGTGATGGTCAGANCTTTNNNTATGCTAAGCAAGCCCTCTAGCATTGAGC
TGGACCCCAACCCTCCTTTTACTTTGATACGGTCTGACTTGTTCACTCTAAATAGAACTGAAGAAGTGCTTTCAGTAGGT
GTATAATTNNCNCTGNNNNTNNNTGTGGGTAAAGGGGAANANAGCTGANAGCAGGATATGCNNGNNGTGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000039357


For any suggestions or comments, please send an email to unitrap@crg.es