Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10255H4
Clone ID IST10255H4
Vector VICTR76
Project tigm

Sequence tag IST10255H4BBF1
Sequence
TCTGANACAATCCACTATTTGAAAATTGTAGCTACTGAATTGCCTCTCANTATGCGAGCTGATCACTTTGCCTTAGGGCC
ACTAGATTTCTGTCTCCCTTAGCCCCTCAAGCCCTTTTGATCATGANTTCCAAACCAAAAATAAATAAATGAACAGTGAG
GCAGTCCCTTGCAGTACCACTGTCATGGGTCAGGCTAANCCTCCTGCTTTTCTGAATTANTCAAGAAAAGCCTTGGTTTC
CCTTTTTCCATCTCTTTATCTTGTCTTTNANATACTGGCCAGAGCCTGGACACTCTTCCTCTGANATCTG
Sequence Type genomic DNA
Unitrap ID UNI32283

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 26247597..26247905 293
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074272 (Ceacam1) NM_001039186 carcinoembryonic antigen-related cell adhesion molecule 1 Gene [Source:MGI Symbol;Acc:MGI:1347245]


Sequence tag IST10255H4HMF1
Sequence
CAGCATAACANACNANNTTTGTNNGGTGTCNCCGAGTAAATANTGGGTTNTTAAATGTGATTGCTGNTNACTANTNNNTA
NTTCTTAANGTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000074272


For any suggestions or comments, please send an email to unitrap@crg.es