Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P080H12
Clone ID P080H12
Vector FlipROSACeoC-2
Project ggtc

Sequence tag P080H12
Sequence
CTTNNNNTCCNNCCCAGAAATCGTCTGTGACCCCTTATCTGACTACAACGTATGGAGCATGCTTAAGCCTATAAATACAT
CTGTGGGACTAGAACCTGACGTCAGGGTTGTGGTTGCGGCCACACGGCTGGATAGCCGGTCCTTTTTCTGGAATGTGGCC
CCAGGGGCTGAAAGTGCTGTAGCCTCCTTTGTCACTCAGCTGGCTGCAGCTGAAGCTTTGCACAAGGCACCTGATGTGAC
CACTCTATCCCGAAATGTGATGTTTGTCTTCTTCCAGGGGGAAACTTTTGACTACATTGGCAGCTCACGGATGGTCTATG
ATATGGAGAACGGCAAGTTTCCCGTGCGGCTCGAGACCATCGACTCCTTCGTGGACATGGGACAGGGGGCCCTAAGACCT
TCACTAGATCTCTGGATGCACACAGATCCCATGTNNCAGAAAAATGAGTCTGTGAAAAACCA
Sequence Type mRNA
Unitrap ID UNI11339

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 174001383..174002716 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003458 (Ncstn) NM_021607 nicastrin Gene [Source:MGI (curated);Acc:Ncstn-001]

 
Come back to gene ENSMUSG00000003458


For any suggestions or comments, please send an email to unitrap@crg.es