Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14786E4
Clone ID IST14786E4
Vector VICTR76
Project tigm

Sequence tag IST14786E4HMR1
Sequence
TGTGAAAGACCNAATCTATTATGGGGTCCCAGGAATTGAACTCAGGCTTCAGACTTGATGGCAACTGCCTTTATCCACTG
GCTGGCTTTTGCACTAATTTTTCTTAGCAGTAAATCTAGTTAATGATGTCTATTTGCTCTACTATGCTTTATATTATCAA
AAACATGTATAGCTGCCAAGATTTCCCACAGTATTGACATCTATTCNATATTGACACCTGTGATTTCTTCTTANTCNCTG
AGGCTGANTNNNTTTTTTTTTGGGGGGGNGGTTN
Sequence Type genomic DNA
Unitrap ID UNI20489

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 17758512..17758785 252
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037369 (Utx) NM_009483 ubiquitously transcribed tetratricopeptide repeat gene, X chromosome Gene [Source:MGI (curated);Acc:Utx-001]


Sequence tag IST14786E4HMF1
Sequence
ACATGTCCTATGGCACATTCATGGGCATGTGCACAAATAAATGAAATTTATAATTTTTAATTAACACAAGATAATGTAAG
GTGTTGGGTGACTGTTTGGTCTATAGCATGTCCTTACTTTAATATACTCTCACAAAAATACCCAGGGTTTGTTTGTTAAG
CTTTGCTTACACCAGTGACCATCCAATCACAAGAGAAAACATACTAGATACAAGTAACAGAAATGTTATTACAGAGAAAA
CATTAAACTCTACTTATTTTCTACAAGTAAATCACTTAACCAGCTTTGACAGTCTAAGCAGCTAAGTCTGATGATAGGGC
CAGGGAAGATATGAAAGGAGAAAGAAAATATACATAGAACCCACAATCATCAGAAGAAATAACTACCTACTCTTTTCCAC
CTATTCCTCCAGGTATCAATTCTCTTAAGANCCACTCCTTCCTTATNNNATGGTTTTCCTTGACTCTTTTAACAAAATCC
TACCTGANACACACACNACTGCCCAGANNNGANATNATTCTAACATTTACTGNNNTTTANCANGTCCCTTATCNTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 17757959..17758514 522
NO GENE  

 
Come back to gene ENSMUSG00000037369


For any suggestions or comments, please send an email to unitrap@crg.es