Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AY0053
Clone ID AY0053
Vector pGT0lxr
Project sanger

Sequence tag AY0053
Sequence
GATGAAGATGAGGAGGAGAAGGAGAAGCGCAGTCGCAAGAAGCCTAGTGAGCTGCGCATTCATGACCTGGAGGATGACCT
GGAAATGTCCTCCGATGCCAGCGATGCCAGTGGTGAAGAGGGCAGCAGAACCTCCAAGGCTAAGAAAAAGGCCCCTGTGA
CCAAGGCAGGCAGGAAGAAGAAAAAGAAGAAGGGCTCAGATGATGAGGCTTTTGAGGACAGCGATGATGGGGACTTCGAG
GGCCAGGAGGTAGACTACATGTCTGATGGCTCCAGCAGCTCTCCAGATGAGACAGAAGGCAAGCCCAAAGTGCCCCAGCA
GGAGGATGGCCCAAAGGGGGTGGATGAGCAGAGCGAGAGCAGTGAGGAGAGTGAGGAGGAGAAGCCCCCCGAGGAGGACA
AGGAGGAGGAAGAAGAGAAGAAGGCCCCCTCCCCTCAAGAGAAGAAGGGCAGGAAAGACAGCAGGGATGAGTCAGACAGC
TCAGAAGAGAGCGACATGGACAGTGAGACCTCTCTCGCACTCATCAAGGCG
Sequence Type mRNA
Unitrap ID UNI1634

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 57143545..57144903 155
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002658 (Gtf2f1) NM_133801 general transcription factor IIF, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:1923848]

 
Come back to gene ENSMUSG00000002658


For any suggestions or comments, please send an email to unitrap@crg.es