Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P094E09
Clone ID P094E09
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P094E09
Sequence
CACCTCCCCAGCATTGGAGCCCGAGTTTTGCGGCATGAGCCGGCGCACCTGCAGTGACCTGCGCCGGCCGTCCTCCTGTC
CCTGCCGTCTTGGCGCGCGGACTACCGTGGACG
Sequence Type mRNA
Unitrap ID UNI11452

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 4541170..4541282 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019773 (Fbxo5) NM_025995 F-box protein 5 Gene [Source:MGI (curated);Acc:Fbxo5-001]

 
Come back to gene ENSMUSG00000019773


For any suggestions or comments, please send an email to unitrap@crg.es