Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12008D9
Clone ID IST12008D9
Vector VICTR76
Project tigm

Sequence tag IST12008D9HMF1
Sequence
GGTGTTGGGTGGGGAGACTCCTTTGAGTCTAGTTTGCACCTCAATTTAATCTGTCTGATTGGTGCTGCGAGGGTCGTGTG
AGAATTTGTAAGTGAGGAGTGCGTGAATTTTGTAAAAGGTTTTGGCCTGCTAGCTTTCACTGGA
Sequence Type genomic DNA
Unitrap ID UNI29739

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 93345527..93345669 143
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029381 (Shroom3) NM_001077595 shroom family member 3 Gene [Source:MGI Symbol;Acc:MGI:1351655]


Sequence tag IST12008D9BBF1
Sequence
GGTGTTGGGTGGGGAGACTCCTTTGAGTCTAGTTTGCACCTCAATTTAATCTGTCTGATTGGTGCTGCGAGGGTCGTGTG
AGAATTTGTAAGTGAGGAGTGCGTGAATTTTGTAAAAGGTTTTGGCCTGCTAGCTTTCACTGGCCAAAGCTCTTCTATCC
TCTCTGTATAAATTAGCCCCCCCCTCTTTTTTTTTCANTTGCAGCTACTTTGTGTANCTGCTTGTTANTTGGANTTTCTA
TTCCTGCNCAAACATNNNGACCAAAAAACAANTTGGGGAGGAAAGGGTTTATTTANCTTACACTTCCNTACTGCTGTTCA
TCACCAAGGAANTCAGGACTGGAACTNANNCNGGTCAGGAANCAGGAGCTGATGCANANGCCNTGGANGGATGTTCTTTA
TTGGCTTGCTTCCCCTGGCTTGCTCANCCTGCTCTCTTANANAACNNAGACTACCNNCCCNGGGNNNGNNCCNTCCNCAN
NGGGCTGGNNCCTCTGCANCNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000029381


For any suggestions or comments, please send an email to unitrap@crg.es