Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14800G8
Clone ID IST14800G8
Vector VICTR76
Project tigm

Sequence tag IST14800G8BBF1
Sequence
ACAGAAAAAGCAGTCTTTTTTAATTTTTATTTTATTCCACCCAGCAGGGCAAGAGAACCTTGAAGCTGTAGTCTGGGAGG
CGCTCACGGGGCAATTAAATCAGGACAAAGAAATCAAGAGCTCCACCGTGACCACTCACTGTGCAGACTTGCATAGGCCG
GAACCCAAGTAAAATGGTGGCCCAGCCGTCCAACGACCCTCGTCACTGCCGGACATGCGTCGGCAGGAGCCACACGGGGA
GGGGGCGCCATTGAAACCCTCCCACCGCCCCAGCATCCGGGCACTGGGGCGGGGCGCCCANGCTTCCANAACAATCTGAG
CTCCGGGGAGGGGAGGAGAAAGGNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45709244..45709586 339
 
EST/CDNA Est Name
  BY666984.1 - BY662141.1 - BY406077.1 - BG293379.1 - BY680894.1 - BY675232.1 - BY672539.1 - AA060648.1 - AA764415.1 - AA855193.1 - AW475255.1 - BQ896003.1 - AI931579.1 - CD561879.1 - CF158923.1 - CF161477.1 - CA541287.1 - DV044949.1 - BE377940.1 - CN706293


Sequence tag IST14800G8HMR1
Sequence
CTGTTAAAGTTGTTCCTCACCCCAATGAGGAGATTGTAGTTAAGGGGTGTGAGTACCANGGGTTGCTTGAGGTTCTTTTT
TATGTATTGTTC
Sequence Type genomic DNA
Unitrap ID UNI12431

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45709157..45709247 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023944 (Hsp90ab1) NM_008302 heat shock protein 90kDa alpha (cytosolic), class B member 1 Gene [Source:MGI (curated);Acc:Hsp90ab1-001]


Sequence tag IST14800G8HMF1
Sequence
ACAGAAAAAGCAGTCTTTTTTAATTTTTATTTTATTCCACCCAGCAGGGCAAGAGAACCTTGAAGCTGTAGTCTGGGAGG
CGCTCACGGGGCAATTAAATCAGGACAAAGAAATCAAGAGCTCCACCGTGACCACTCACTGTGCAGACTTGCATAGGCCG
GAACCCAAGTAAAATGGTGGCCCAGCCGTCCAACGACCCTCGTCACTGCCGGACATGCGTCGGCAGGAGCCACACGGGGA
GGGGGCGCCATTGAAACCCTCCCACCGCCCCAGCATCCGGGCACTGGGGCGGGGCNCCNANGCTTCCANANNNNNNTGAG
CTNCGGGGAGGGGNGGANAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45709244..45709580 313
 
EST/CDNA Est Name
  BY666984.1 - BY662141.1 - BY406077.1 - BG293379.1 - BY680894.1 - BY675232.1 - BY672539.1 - AA060648.1 - AA764415.1 - AA855193.1 - AW475255.1 - BQ896003.1 - CF158923.1 - CF161477.1 - CA541287.1 - BE377940.1 - CN706293.1 - CD542287.1 - CA567649.1 - CJ041595

 
Come back to gene BY666984.1 - BY662141.1 - BY406077.1 - BG293379.1 - BY680894.1 - BY675232.1 - BY672539.1 - AA060648.1 - AA764415.1 - AA855193.1 - AW475255.1 - BQ896003.1 - CF158923.1 - CF161477.1 - CA541287.1 - BE377940.1 - CN706293.1 - CD542287.1 - CA567649.1 - CJ041595


For any suggestions or comments, please send an email to unitrap@crg.es