Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14849D11
Clone ID IST14849D11
Vector VICTR76
Project tigm

Sequence tag IST14849D11HMR1
Sequence
AGGTCCTCTGGAACTGGAATTACAAGTGGATGTCAGCCACCATGCAGGTGCTGAGAGTTGAATCCAGGTCCATTGGAAGA
GCAGCCCTGATCTTAACAAGCTGAGCCATCTCTCCAGTCCTCCCGTGTTTACTCTTAAGTAAAACTGTTCTTATGTTTGG
CTCCTTCCTGTCGTTAAGATGAGTTCCTTCTCAAAATGTGATGCAGTAGTGGAAGGTTCTGGAGTCANANGNACTGAGCG
GGATGGAGTTCNGGCGCCATCTNTGGCTNANTGCGGTTGTTNNGNTTTNNCNNGNNCN
Sequence Type genomic DNA
Unitrap ID UNI5107

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154502317..154502604 268
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038467 (Chmp4b) NM_029362 chromatin modifying protein 4B Gene [Source:MGI (curated);Acc:Chmp4b-001]


Sequence tag IST14849D11HMF1
Sequence
ACCTGACACCCTCTTCTGGCCTGCCTGGACACCAGGCATGGTACACATGCATACATGAAAGCAAAGTATCCATATACATA
AAATAAAGCAAAAAAAAAAAAAAAAAAAAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154502210..154502320 111
NO GENE  


Sequence tag IST14849D11BBF1
Sequence
ACCTGACACCCTCTTCTGGCCTGCCTGGACACCAGGCATGGTACACATGCATACATGAAAGCAAAGTATCCATATACATA
AAATAAAGCAAAAAAAAAAAAAAAAAAAAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154502210..154502320 111
NO GENE  

 
Come back to gene ENSMUSG00000038467


For any suggestions or comments, please send an email to unitrap@crg.es