Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15049A6
Clone ID IST15049A6
Vector VICTR80
Project tigm

Sequence tag IST15049A6HMR1
Sequence
CATTGGGAAGGTTGAGAAACTCTGAGCTAGACCGTCATAACTAAGCTTAGTGAGACTGACCACCTGGTAGACCTAAGTCA
TAGTTTTGGAATAATAGTTTCAGTTTGGATTTGTTGCCTGTGACTTCTGGAGAGGCGCTCAGGTGAAGGGGTTCGTATCT
ACTGGGCGAGTTTGACCGAGGTCCATAGGCTGGGAGGTAGATTTGTTTTTCTTCATCATGGAGATGATAAAGCCATGGGT
ACCGGTGAGATCACTAGACAGACCTTGCAGAGAATACATTCAGGACCTGCACCAGTTGTCCGGGTGTGGGGAGGAAATAA
CTCAGGTTATGGGTACCACAGGGCCTAGAGCAGCTCAAGAAGAAAAAGATGAGTCCCGAAGTGGGCACTTCAGGCTGAGA
ACCGAAGCAGANCAGANGAGCTGAGGAACGTGCTCTTGACTTCNGTAACAATCTGTTGAACTAGACTCTTGTCTACTGCC
CACGGCAGANAGCAGCGGGGGAGGAGTNNNCCCCTCNNTGCTTCCANTTTCTNAATTCCTTTNCNTACCCNCNTTTACAG
ANTCNCANANGTCTTGNNTTANGCCN
Sequence Type genomic DNA
Unitrap ID UNI32290

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 126958057..126958641 541
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034906 (Ncaph) NM_144818 non-SMC condensin I complex, subunit H Gene [Source:MGI (curated);Acc:Ncaph-001]

 
Come back to gene ENSMUSG00000034906


For any suggestions or comments, please send an email to unitrap@crg.es