Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10659B12
Clone ID IST10659B12
Vector VICTR76
Project tigm

Sequence tag IST10659B12HMF1
Sequence
AAAGTATATGATGAATGCCAAGCATCCTGTAAAATCAGAGCCTCTTCATTATTTGAGGTTGTATTTGAACAGGAGTGGAA
AACACCCTCATCTTTGGAAAGCCAAACCTTTGAGTATTTTGAATTGTAAGTGACTCCATGTGTCTGGGGGAAAGCATTCC
TAAAGTTTCTTATTTTCCTTTTTTCATTGGGTGATTGTTTCAGAAATTTCTAAATTCATTATCGGGAATGAGTAGCCCAA
GATTTGGA
Sequence Type genomic DNA
Unitrap ID UNI31282

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 9307544..9307790 247
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048264 (Dip2c) NM_001081426 DIP2 disco-interacting protein 2 homolog C (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1920179]


Sequence tag IST10659B12BBF1
Sequence
AAAGTATATGATGAATGCCAAGCATCCTGTAAAATCANAGCCTCTTCATTATTTGAGGTTGTATTTGAACAGGAGTGGAA
AACACCCTCATCTTTGGAAAGCCAAACCTTTGAGTATTTTGAATTGTAAGTGACTCCATGTGTCTGGGGGAAAGCATTCC
TAANGTTTCTTATTTTCCTTTTTTCATTGGGTGATTGTTTCAGAAATTTCTAAATTCATTATCGGGAATGAGTAGCCCAA
AATTTGGCCNNCAGACATGAAGGATGAAAGCCCAGCTGGNNAANATCCTGTGTAGTAGCTGTGCTNNNGANAANTGTGGC
ANANGATTACNGGATTCTTTCCGGANTTCTCTTGCTGCCTTCNNNNNNTGATNANTGTCTNAGTNACTGNTCTATTGCTG
TGANANANACCNNGACCTNNNTAACTCTN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000048264


For any suggestions or comments, please send an email to unitrap@crg.es