Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14503D8
Clone ID IST14503D8
Vector VICTR74
Project tigm

Sequence tag IST14503D8HMR1
Sequence
ACATATCAAAATAAAAGTTTGGGCCTGTAGAGGCCTGTCC
Sequence Type genomic DNA
Unitrap ID UNI5311

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 96837867..96837905 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018678 (Sp2) NM_030220 Sp2 transcription factor Gene [Source:MGI (curated);Acc:Sp2-001]


Sequence tag IST14503D8BBF1
Sequence
TAANAATCCTGTNACCTCCTAAAAANGGGGAAAGTTNAGGNNAAAAAACCAAACAGAGTCCCCCNGGNNNNTGTTAGTTA
TGAAACGATTAAACATGACAGGCTATTANAATCAAAACCAAGGAANGTNNAGAGGACAGGTTTCTCAGTCNCCCAGCGCA
AAAGANAGTTCCTTTTCTACTAAAACTAGAATAAGGNACTGGGAAANAAACCTAANANNGNNNGGNNANANTCTGANCAC
CCTTAAGCCNGCNNCGCGGANGAANAAAAGCATCTATTTTATTTCTTANGTCATCTGTTACNANCGATAGCGCCTACNCT
TTTTTGNAATTCCAGTGCATTTTTGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000018678


For any suggestions or comments, please send an email to unitrap@crg.es