Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12900C10
Clone ID IST12900C10
Vector VICTR76
Project tigm

Sequence tag IST12900C10BBF1
Sequence
CTACCTGTTTGATTGTGTTTTCCTGTTTTTCTTTAAGGACTTGTAACTCTTTAGCAGTGTTCTCCTGTATTTCTTTAAGT
GATTTATTAAAGTCCTTCTTGANGCCCTCTACCATCATCATGAGATATGCTTTTAAATCCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI4014 UNI32291

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 100264089..100264234 140
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 33102212..33102357 140
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 33774636..33774781 140
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35520853..35520998 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041408 (Wapal) NM_001004436 wings apart-like homolog (Drosophila) Gene [Source:MGI (curated);Acc:Wapal-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 4621574..4621719 140
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 25191641..25191786 140
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 47087699..47087844 140
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 51666553..51666698 140
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 29504350..29504495 140
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 73295950..73296095 140
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 62340765..62340910 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063297 (Luzp2) NM_178705 leucine zipper protein 2 Gene [Source:MGI Symbol;Acc:MGI:1889615]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 108900659..108900804 140
NO GENE  


Sequence tag IST12900C10HMF1
Sequence
CTACCTGTTTGATTGTGTTTTCCTGTTTTTCTTTAAGGACTTGTAACTCTTTAGCAGTGTTCTCCTGTATTTCTTTAAGT
GATTTATTAAAGTCCTTCTTGATGTCCTCTACCATCATCATGAGATATGCTTTTAAATCTAGGTCTAGGTTCTCAGGTGT
GTTGGGGTTCCCTGGACTGGGCGAAGTGGGTGTGCTGGGTTCTGGTGATGGTGAGTGGTCTTGGTTCCTGTTAGTAAGAT
TCCTCCGTTTACCTTTCGCCATCTGGTAATCTCTGGANTTAGTAGTTATAGTNNACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166307: 48338..48629 290
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166438: 134248..134539 290
NO GENE  

 
Come back to gene ENSMUSG00000063297


For any suggestions or comments, please send an email to unitrap@crg.es