Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14288H7
Clone ID IST14288H7
Vector VICTR74
Project tigm

Sequence tag IST14288H7HMF2
Sequence
CCAGCAACCACCCCCGCCCACGCTTGGGACCCTGAAGTTGGCACCGGCTGAAGAAGCCAAATCCAGTGAACAGAAGAAAA
GGCCTGGAGGGTGAGTGGGGTACCCCAGAGGGGTCTGGTGGGATGGGAGACGACTGTCAATCTTGGGCTGGGAATGCAAG
AGAAGATACCCTGGCCAGCC
Sequence Type genomic DNA
Unitrap ID UNI30025

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 74650361..74650539 179
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000282 (Mnt) NM_010813 minute imprinted gene in the Igf2 region Complex/Cluster/Region [Source:MGI (curated);Acc:Mnt-001]


Sequence tag IST14288H7BBF1
Sequence
NCNNNNNNNNNCCNNNNCACGCTTGGNACCCTGAANTTGGCNCCGGCTGANNAANCCNAANCNNNTGAANANAANAAAAG
GCCTGGAGGGTGANTGNNGTACCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000000282


For any suggestions or comments, please send an email to unitrap@crg.es