Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14566E7
Clone ID IST14566E7
Vector VICTR74
Project tigm

Sequence tag IST14566E7HMR1
Sequence
ATTGTNNGACCTGCCCTTTTACTTATTTTACTCTTTAATTGTATTTTTTCAGTGCTGGGGATCCAGCCCCTCAGCTCCAC
CCCTTCCAGTACCTTCCTCAAGCCCCGTGTCCTGTCCACCAGTCCTCTCCCCAGCCCCCTTGCCTTCTTTTGTGTCTGTG
CCACTGCANAGCCCACANACTCCATTTCANATTCATCTCCAGTCTCTGCTGGACCACTGCCCGGGTGGGTGTTTGTGGAA
GCGATGANGAGCTGGAATGGGGGCACAGTCCTCCTTCCTGTANACCGCANACCANTTCTCANCC
Sequence Type genomic DNA
Unitrap ID UNI14300

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121243530..121243830 283
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032536 (Trak1) NM_175114 trafficking protein, kinesin binding 1 Gene [Source:MGI Symbol;Acc:MGI:1914345]


Sequence tag IST14566E7HMF1
Sequence
NNNNNATACTATANACAGGGTTACATGTNNNTNTATACNCTTAANATGTGANACCANGTCGTCTNTNCCTANNCACCCGC
NCACNCNNTNCNTTGCTAANNTCNAATGACANGAAACNNGCNNCATCCNTNNNGGGAACCCANNNNNCCAANACAAAGGA
NCTACCANCCNCTGACTCNNAGAATCCNNNNTGAAAACCTGTCCNNTACCCTGTCACTTANNGNNNNNCCTGCANCCACC
CNTGCTGTTCCNACAGCCTCCNNCNNCCCCCTGGGAANAGGCCNNTNNNACATGANAGGANNACCTCCCCTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14566E7BBF1
Sequence
ACAATATACTATAGACAGGGTTACATGTAAATCTATACACTTAACATGTGAGACCAGGTCGTCTCTCCCTACACACCCGC
ACACACCCTCCCTTGCTCAAATCAAATGACAGGATACAGGCAGCATCCTTCAAGGGAACCCAACAGCCCAAGACAAAGGA
ACTACCAGCCACTGACTCCCAGAATCCCCAGTGAAAACCTGTCCAGTACCCTGTCACTTAAGGTCCAGCCTGCAGCCACC
CATGCTGTTCCCACAGCCTCNAACAGCCCCCTGGGAAGAGGCCTATCAGACATGAGAGGAAAACCTCCCCTCCAGATTCT
AGACACGGAGACAATGGAATGGCAGAACTGAAGAATCAGGGACAATACGGGCAACAGAAAAGAGCTTCAAAGAAGGAGAC
TGTAACAGGAAAACCCAGCTGAACACTATTCCCAAATAGAAGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121243092..121243534 441
 
EST/CDNA Est Name
  BB861417.1

 
Come back to gene BB861417.1


For any suggestions or comments, please send an email to unitrap@crg.es