Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11314D6
Clone ID IST11314D6
Vector VICTR76
Project tigm

Sequence tag IST11314D6HMF1
Sequence
CTTCCCTGTCCCCAGAGCTGTANAGACTTTANTACCTGTGATCCAGCTTTCCAAGCCTTCACTGCTAGGCCATATTGACA
GGTCACTGAGAGGAGAGAGCANATGAAGGGTTAGAGCCCATGGCCCATGGGTTCGCGGCTAGCCCCTTCCGCTGCTTTGC
TTCTGCCTGGGAATGGAAATGGAGCGGGTAAAGAGGTGAAGGCCCTGGGGATGGGTCTGGGAAAACGAGTTATCCTTAAT
TGAGGTGGGCTATTCAAGANAATANCATAAATGANNNTCTGGATTTGGATATGGAAAGGGGGGTGGAAAAACGGANNCNA
TGGAAGGACTGGA
Sequence Type genomic DNA
Unitrap ID UNI32294

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 37636348..37636679 310
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029121 (Crmp1) NM_007765 collapsin response mediator protein 1 Gene [Source:MGI Symbol;Acc:MGI:107793]


Sequence tag IST11314D6BBF1
Sequence
CTTCCCTGTCCCCAGAGCTGTANAGACTTTACTACCTGTGATCCAGCTTTCCAAGCCTTCACTGCTAGGCCATATTGACA
GGTCACTGAGAGGAGAGAGCAGATGAAGGGTTAGAGCCCATGGCCCATGGGTTCNCGGCTAGCCCCTTCCGCTGCTTTGC
TTCTGCCTGGGAATGGAAATGGAGCGGGTAAAGAGGTGAAGGCCCTGGGGATGGGTCTGGGAAAACGAGTTATCCTTAAT
TGAGGTGGGCTATTCAAGAGAATAGCATANATGAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI32294

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 37636348..37736599 273
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029121 (Crmp1) NM_007765 collapsin response mediator protein 1 Gene [Source:MGI Symbol;Acc:MGI:107793]

 
Come back to gene ENSMUSG00000029121


For any suggestions or comments, please send an email to unitrap@crg.es