Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14659H9
Clone ID IST14659H9
Vector VICTR74
Project tigm

Sequence tag IST14659H9HMR1
Sequence
TCTCCNAAGTGAGTGCCAGGACAGCCAGAGCTACACAGAGAAACCTTGTCTNAAAAAAAGAAAAAAGAAAAAAAATTTTA
AATATATGCATGTGTTTGGGTGTGTGGATGTGAGTACAGGTGCCCACCCAGGCCAGAGGCCGGGAGTTACAGGTGGCTGG
GCTATCTGACCTGGTTGCTGGAAATANAACTCAGGTCCTCTGAAAGAGCANCAACCACTCTATCTCTGAACTGTTTCTTC
TTTGTGATTCTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI18231

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114398638..114398898 253
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031953 (Tmem170) NM_025781 transmembrane protein 170 Gene [Source:MGI Symbol;Acc:MGI:106426]


Sequence tag IST14659H9HMF1
Sequence
GAGACCAGGCTGGCCTCGAACTCAGAGATCTGCCTGCCTCTGCCTCCTGAGTGCTGGGATTAAAGGCGAGCGCCACGATG
CCCGGCAATTTTTTGTTTTTAAGAAAAAAGCTATTTGGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114398895..114399014 120
NO GENE  


Sequence tag IST14659H9BBF2
Sequence
GAGNCCAGGCTGGCCTCGAACTCAGAGATCTGTCG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000031953


For any suggestions or comments, please send an email to unitrap@crg.es