Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12322H5
Clone ID IST12322H5
Vector VICTR76
Project tigm

Sequence tag IST12322H5BBF1
Sequence
ACCTATGTGCATGGGCATGAGGGTATGTCTGTGTGTGTGCCCCCTTGTTTTTACCTATGTTCTGGGTTGTGGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI13763

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62654216..62654294 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020067 (Mypn) myopalladin Gene [Source:MGI Symbol;Acc:MGI:1916052]


Sequence tag IST12322H5HMF1
Sequence
ACCTATGTGCATGGGCATGAGGGTATGTCTGTGTGTGTGCCCCCTTGTTTTTACCTATGTTCTGGGTTGTGGAGATCTGA
ACTCTGGTCCTCATGTTTGTGCTTCAATCCACCGAGCCATTCCTCTGGCTTGAAAATGTATAGATTTGTACATTTTTGCC
TGGCTGATTGACCAGTTTTGGGTGACTATTGAATTACTTCTATTTGGGGAAGAGGTACTTTATAATTGTAGTTGCTTTTG
TTTGTTTGTTTGTTTGTTTTTGGATGGTGTACTGAACTGATTCTTGTANCTGANACTGTCACCATTGAGAAATGTNNAGA
ATGANTGATTTAAACCGGGCGTGGTGGTGCACNCCTTNNATCCCANCACTCANGANGCAGAGGCAGGTGGATTTCTGANT
TCNANGCCNGCCTGGTCTACANAGTGAGTTCCNNGACANCNNNGGCTATNCNNANAAACCCTGTCTCGAAAAACNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000020067


For any suggestions or comments, please send an email to unitrap@crg.es