Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P079B12
Clone ID P079B12
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P079B12
Sequence
CTTTTACGACGGAGCCTAAGATATTCTTTGTCTTGTCG
Sequence Type mRNA
Unitrap ID UNI4846

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 88417689..88417726 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032424 (2810026P18Rik) RIKEN cDNA 2810026P18 gene Gene [Source:MGI Symbol;Acc:MGI:1919905]

 
Come back to gene ENSMUSG00000032424


For any suggestions or comments, please send an email to unitrap@crg.es