Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12994B11
Clone ID IST12994B11
Vector VICTR76
Project tigm

Sequence tag IST12994B11HMF2
Sequence
AGANAATGTGCATGTGTGTGTGCCACAATGAAATTGTGCAAATCTGAGGACAACTTGTTGGAGTCAGTTCAGTCCTTTTA
TCTTTATCATGTGGCCTGTGGGAATCAAACTCAGGTAGCAAGGCTTANCANCAAGCTACTTTACCCTCTGANCAGGTCCA
NAATCTTTAATCTTTTTNAACTGGAGGGCAGTGGA
Sequence Type genomic DNA
Unitrap ID UNI5525

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 26062020..26062213 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005442 (Cic) NP_082158 capicua homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1918972]


Sequence tag IST12994B11BBF1
Sequence
GGCACACTGCATATTAGGTTCTTTGATAATTAACTGAGATGATTAACAGGTATCAACAGAGCCCTTTCCTTCCTAAGGAA
CCTCACTATATGTCAGGGTCTATCTGTAGACCTTTCCAAGCGTANTGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI16052

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 75740579..75740712 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052928 (Gm672) NM_201354 gene model 672, (NCBI) Gene [Source:MGI Symbol;Acc:MGI:2685518]

 
Come back to gene ENSMUSG00000052928


For any suggestions or comments, please send an email to unitrap@crg.es