Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11007D6
Clone ID IST11007D6
Vector VICTR76
Project tigm

Sequence tag IST11007D6BBF1
Sequence
GCCGAGGCGGAGGAGTACAGTGATTTCAAGTGCAGCCTGGGCTACAGAGATAGATCCTTTCTNCGAANANAAAGAGAAAG
AGAGAAAGGAAAACAGAAGCAAGCCAGCGAGAAGGAGGTCCACGTGTGTAAGCCCAGCACTTGGAAGGTGGAGGCAGGAA
GATCTG

Sequence Type genomic DNA
Unitrap ID UNI13419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62351195..62351359 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018509 (Prr6) proline-rich polypeptide 6 Gene [Source:MGI (curated);Acc:Prr6-001]


Sequence tag IST11007D6HMF1
Sequence
GCCGAGGCGGAGGAGTACAGTGATTTCAAGTGCAGCCTGGGCTACAGANATAGATCCTTTCTCCGAANNNAAAGAGAAAG
AGAGAAAGGAAAACAGAAGCAAGCCAGCGAGAAGGAGGTCCACGTGTGTAAGCCCAGCACTTGGAAGGTGGAGGCAGGAA
GATCTACAAGTTCAAGGTCATCCTTGACCACATAGTTAATTTGAGGCCNGCTTGAGCTGCACTGACACCCTGTCTCAAAA
GGAAACAAAAAAGCCCCCCACACACACACACAAAGCAAAAATTTNNANGTAATATTTTCCCCTAAAACAAAATGGTAATG
ATCTTTAAAAAAGATACTAAAAATATTGGCANGAAAAGAGGCATTTCACTCACCANAATANCGTGCTGTATGCTTGCTTA
CATCCACTCTATGGTCTTTNAAGCTAACTTTTATACNAAGANNNNNNATGTTANATACACTAACATTTGGTTCCNATATC
GCANAAAATTGGANGANTGGATAGCANATACNGNCTCTCN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000018509


For any suggestions or comments, please send an email to unitrap@crg.es