Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14330B8
Clone ID IST14330B8
Vector VICTR74
Project tigm

Sequence tag IST14330B8HMR1
Sequence
CACTCTTGATGTGAACCAAGGCTCTTAAAGTCAGGGGAAGAAGGCANACCCTCTTGGGATAGTACTATTTTCTTTCCTTA
TCAGCATCCTTCCCTGATACCTGACAGAGACAGGATGAAGTTCTCTTATCCTGGAGTTGGATCCCCTGCACTACTGAATG
AATGCCCATTTTCTGTTCCCCTGAAGGAATGGCTTTCTGGTTCTCTTATGGTTCCCTGGGGAGATAACAGTTGTGACCCC
TCTTTACACAGTGCCCAGCANACCCTCAACTATTTCTGATTTCNNNTCNGCCCTTGATGGATGTCCATCGTCCCCAGTCC
CAGACTGATGTTACCNCNTTGANAACACTANNTCCNTANNGATCCCTGGGAGTAAACTGCN
Sequence Type genomic DNA
Unitrap ID UNI29628

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97665768..97666147 350
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038366 (Lasp1) NM_010688 LIM and SH3 protein 1 Gene [Source:MGI (curated);Acc:Lasp1-001]


Sequence tag IST14330B8BBF1
Sequence
NNTGGACCTGCTTACAAGGTCCCAGACAGANACNCACTCCTAGGACTTGTGACTGAGGAANCNACCCACACCTGGAGCCN
TGCAGCTCAAATTCCCTANTCACGGGTCTGTCAGGCCGCTCANTCANACCCCAGGTACCANAAGACAACTACCCACCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000038366


For any suggestions or comments, please send an email to unitrap@crg.es