Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11993H10
Clone ID IST11993H10
Vector VICTR76
Project tigm

Sequence tag IST11993H10HMR1
Sequence
NNNTAATAATTGGATTGTGTGTTTTTATATGGGCTTATTGGAGTTGGAAATTCCAGCAACAAACTGAGTTTATTGTTTTT
GAAGCATGTTATCCAGCTCTCTGGCAATGAAGTGCAGACTGCTAACTCTCCAAGCCATAGCTAGGAGTTATTGCTTTGTT
ACTGGGGTCCTCTTTGAAGCATTTTGTTCTACTATCTAAATGCAACTTTTGGGAAAAAATTAAAAT
Sequence Type genomic DNA
Unitrap ID UNI19977

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 164856528..164856750 223
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039804 (Ncoa5) NM_144892 nuclear receptor coactivator 5 Gene [Source:MGI (curated);Acc:Ncoa5-007]

 
Come back to gene ENSMUSG00000039804


For any suggestions or comments, please send an email to unitrap@crg.es